pCRII-Topo Hspb3 in situ probe
(Plasmid
#45629)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45629 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRII-Topo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4600
-
Vector typein situ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHspb3 in situ probe
-
Alt nameheat shock protein 3
-
Alt nameHspb3
-
Alt namespb3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)632
-
Mutationfragment contains nt 30-661 of Hspb3 mRNA sequence (BC065388.1)
-
GenBank IDBC065388.1
-
Entrez GeneHspb3 (a.k.a. 2310035K17Rik, AI844863, Hsbp3, spb3)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Rev, Sp6
- 3′ sequencing primer T7, M13 Forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Hspb3 fragment was amplified by RT-PCR using the following primer pair:
TGATTCAGCCCCAATTAAGC
CTGGGGTATGAAGAGCAACC
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo Hspb3 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45629 ; http://n2t.net/addgene:45629 ; RRID:Addgene_45629) -
For your References section:
Novel subtype-specific genes identify distinct subpopulations of callosal projection neurons. Molyneaux BJ, Arlotta P, Fame RM, MacDonald JL, MacQuarrie KL, Macklis JD. J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009. 10.1523/JNEUROSCI.6108-08.2009 PubMed 19793993
Map uploaded by the depositor.
