pCRII-Topo Tcrb-V13 in situ probe
(Plasmid #45622)

• Depositing Lab: Jeffrey Macklis
• Publication: Molyneaux et al Neuron. 2005 Sep 15;47(6):817-31.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4500
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tcrb-V13 in situ probe
• Alt name: T cell receptor beta chain
• Alt name: TcrB
• Species: M. musculus (mouse)
• Insert Size (bp): 527
• Mutation: fragment contains bp# 533-1058 of X67128
• GenBank ID:
• Entrez Gene: Tcrb (a.k.a. TCRbeta, Tib)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Tcrb-V13 fragment was amplified by RT-PCR using the following primer pair:
CTGAGCTGGTGGGTGAATG
AAGGTGTCAACGAGGAAGGA

For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 533-1058 of X67128, not bp# 532-1059 as indicated on plasmid map. The plasmid functions as described in the associated publication.