pCRII-Topo S100a10 in situ probe
(Plasmid #45603)

• Depositing Lab: Jeffrey Macklis
• Publication: Arlotta et al Neuron. 2005 Jan 20;45(2):207-21.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4250
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: s100a10 in situ probe
• Alt name: S100 calcium binding protein A10
• Alt name: calpactin
• Alt name: s100a10
• Species: M. musculus (mouse)
• Insert Size (bp): 250
• Mutation: fragment contains bp# 21-275 of BC025044
• GenBank ID: BC025044
• Entrez Gene: S100a10 (a.k.a. 42C, AA409961, AL024248, CAL12, CLP11, Cal1l, p10, p11)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Fragment was amplified using the following primers:
GCCCAGGTTTCGACAGACT
CCACTAGTGATAGAAAGCTCTGGA

For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 21-275 of BC025044, but found single nucleotide mismatches at bp#129 & 190. The plasmid functions as described in the associated publication.