pCRII-Topo S100a10 in situ probe
(Plasmid
#45603)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45603 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRII-Topo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4250
-
Vector typein situ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert names100a10 in situ probe
-
Alt nameS100 calcium binding protein A10
-
Alt namecalpactin
-
Alt names100a10
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)250
-
Mutationfragment contains bp# 21-275 of BC025044
-
GenBank IDBC025044
-
Entrez GeneS100a10 (a.k.a. 42C, AA409961, AL024248, CAL12, CLP11, Cal1l, p10, p11)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Rev, Sp6
- 3′ sequencing primer T7, M13 Forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Fragment was amplified using the following primers:
GCCCAGGTTTCGACAGACT
CCACTAGTGATAGAAAGCTCTGGA
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 21-275 of BC025044, but found single nucleotide mismatches at bp#129 & 190. The plasmid functions as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo S100a10 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45603 ; http://n2t.net/addgene:45603 ; RRID:Addgene_45603) -
For your References section:
Neuronal subtype-specific genes that control corticospinal motor neuron development in vivo. Arlotta P, Molyneaux BJ, Chen J, Inoue J, Kominami R, Macklis JD. Neuron. 2005 Jan 20;45(2):207-21. 10.1016/j.neuron.2004.12.036 PubMed 15664173
Map uploaded by the depositor.
