pCRII-Topo Diap3 in situ probe
(Plasmid #45602)

• Depositing Lab: Jeffrey Macklis
• Publication: Arlotta et al Neuron. 2005 Jan 20;45(2):207-21.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4700
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Diap3 in situ probe
• Alt name: Diap3
• Alt name: diaphanous homolog 3 (Drosophila)
• Species: M. musculus (mouse)
• Insert Size (bp): 695
• Mutation: fragment contains bp# 1589-2321 of BC028920
• GenBank ID: BC028920
• Entrez Gene: Diaph3 (a.k.a. 4930417P13Rik, Dia2, Diap3, Drf3, p134MDia2)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Fragment was amplified using the following primers:
AGCAGTTCGCTGTTGTGATG
GCACGTTTCTCCTTTTCTGC

For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication.