pCRII-Topo Crym in situ probe
(Plasmid #45601)

• Depositing Lab: Jeffrey Macklis
• Publication: Arlotta et al Neuron. 2005 Jan 20;45(2):207-21.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4400
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Crym in situ probe
• Alt name: mu-crystallin
• Alt name: crystallin, mu
• Alt name: Crym
• Species: M. musculus (mouse)
• Mutation: fragment contains nt 756-1191 of NM_016669
• GenBank ID: NM_016669
• Entrez Gene: Crym

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Fragment was amplified using the following primers:
ACTGGCGAGAACTGGATGAC
GCCATCACCCCTTAACAGAA
For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.