pCRII-Topo Crym in situ probe
(Plasmid
#45601)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45601 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRII-Topo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4400
-
Vector typein situ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCrym in situ probe
-
Alt namemu-crystallin
-
Alt namecrystallin, mu
-
Alt nameCrym
-
SpeciesM. musculus (mouse)
-
Mutationfragment contains nt 756-1191 of NM_016669
-
GenBank IDNM_016669
-
Entrez GeneCrym
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Rev, Sp6
- 3′ sequencing primer T7, M13 Forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Fragment was amplified using the following primers:
ACTGGCGAGAACTGGATGAC
GCCATCACCCCTTAACAGAA
For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo Crym in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45601 ; http://n2t.net/addgene:45601 ; RRID:Addgene_45601) -
For your References section:
Neuronal subtype-specific genes that control corticospinal motor neuron development in vivo. Arlotta P, Molyneaux BJ, Chen J, Inoue J, Kominami R, Macklis JD. Neuron. 2005 Jan 20;45(2):207-21. 10.1016/j.neuron.2004.12.036 PubMed 15664173
Map uploaded by the depositor.
