pCRII-Topo Crim1 in situ probe
(Plasmid #45600)

• Depositing Lab: Jeffrey Macklis
• Publication: Arlotta et al Neuron. 2005 Jan 20;45(2):207-21.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4400
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Crim1 in situ probe
• Alt name: cysteine rich transmembrane BMP regulator 1 (chordin like)
• Alt name: Crim1
• Species: M. musculus (mouse)
• Insert Size (bp): 440
• Mutation: insert contains bp#4062-4502 of NM_015800.3
• GenBank ID: NM_015800 XM_128751
• Entrez Gene: Crim1 (a.k.a. AU015004)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Fragment was amplified using the following primers:
TCTCAAGACTGTTGGTTGCTG
TGAACAACCAATGATAGCACAG

For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp#4062-4502 of NM_015800.3, not bp# 4708-5148 as indicated on plasmid map. The plasmid functions as described in the associated publication.