Skip to main content
Addgene

pQuantA-hygro-amp
(Plasmid #45584)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45584 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSilencer 2.1-U6 hygro
  • Backbone manufacturer
    Ambion
  • Vector type
    Cre/Lox ; DT40 cell line targeting
  • Selectable markers
    Hygromycin
  • Tag / Fusion Protein
    • Quant-A tag (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGGACTTTCCACACCTGG
  • 3′ sequencing primer GGGTTTTGTTTCATCACAGGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQuantA-hygro-amp was a gift from Andrzej Dziembowski (Addgene plasmid # 45584 ; http://n2t.net/addgene:45584 ; RRID:Addgene_45584)

  • For your References section:

    A new strategy for gene targeting and functional proteomics using the DT40 cell line. Orlowska KP, Klosowska K, Szczesny RJ, Cysewski D, Krawczyk PS, Dziembowski A. Nucleic Acids Res. 2013 Sep;41(17):e167. doi: 10.1093/nar/gkt650. Epub 2013 Jul 27. 10.1093/nar/gkt650 PubMed 23892402
Related items:
Commonly requested with: