pCVL.SFFV.Kozak.HA.NLS.Y2Ani.IRES.BFP
(Plasmid
#45578)
-
PurposeExpresses Y2 variant of I-Ani I nuclease in mammalian cells with BFP tracker
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCVL
- Backbone size w/o insert (bp) 5071
- Total vector size (bp) 7671
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecoY2 Ani
-
Alt nameY2 Ani Cleavase
-
Insert Size (bp)762
-
Mutationco indicates codon optimization for mammalian expression.
- Promoter SFFV
-
Tags
/ Fusion Proteins
- HA (N terminal on backbone)
- NLS (N terminal on backbone)
- IRES BFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer SFFVpro-F (CTTCTGCTTCCCGAGCTCTA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCVL.SFFV.Kozak.HA.NLS.Y2Ani.IRES.BFP was a gift from Andrew Scharenberg (Addgene plasmid # 45578 ; http://n2t.net/addgene:45578 ; RRID:Addgene_45578) -
For your References section:
Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks. Kuhar R, Gwiazda KS, Humbert O, Mandt T, Pangallo J, Brault M, Khan I, Maizels N, Rawlings DJ, Scharenberg AM, Certo MT. Nucleic Acids Res. 2013 Oct 10. 10.1093/nar/gkt872 PubMed 24121685