pCVL.SFFV.Kozak.HA.NLS.Y2Ani.IRES.BFP
(Plasmid #45578)

• Purpose: Expresses Y2 variant of I-Ani I nuclease in mammalian cells with BFP tracker
• Depositing Lab: Andrew Scharenberg
• Publication: Kuhar et al Nucleic Acids Res. 2013 Oct 10.

Backbone

• Vector backbone: pCVL
• Backbone size w/o insert (bp): 5071
• Total vector size (bp): 7671
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: coY2 Ani
• Alt name: Y2 Ani Cleavase
• Insert Size (bp): 762
• Mutation: co indicates codon optimization for mammalian expression.
• Promoter: SFFV
• Tags / Fusion Proteins:
  • HA (N terminal on backbone)
  • NLS (N terminal on backbone)
  • IRES BFP (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: SFFVpro-F (CTTCTGCTTCCCGAGCTCTA)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry