pCVL.SSA TLR (Ani)
(Plasmid #45577)

• Purpose: Codes for the SSA-TLR with the target site for I-Ani I in a lentiviral backbone
• Depositing Lab: Andrew Scharenberg
• Publication: Kuhar et al Nucleic Acids Res. 2013 Oct 10.

Backbone

• Vector backbone: pCVL
• Backbone size w/o insert (bp): 5069
• Total vector size (bp): 10434
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: 5' iRFP arm
• Insert Size (bp): 837
• Mutation: truncated 38 amino acids from C terminus
• Promoter: SFFV

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: SFFVpro-F (CTTCTGCTTCCCGAGCTCTA)

Gene/Insert 2

• Gene/Insert name: eGFP with I-Ani I TS
• Species: H. sapiens (human)
• Insert Size (bp): 759
• Mutation: embedded I-Ani I TS from 163-185bp

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: mCherry-R

Gene/Insert 3

• Gene/Insert name: +3 mCherry
• Insert Size (bp): 708

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: EGFP-C

Gene/Insert 4

• Gene/Insert name: 3' iRFP arm
• Insert Size (bp): 876
• Mutation: truncated 25 amino acids on the N terminus

Cloning Information for Gene/Insert 4

• Cloning method: Unknown
• 5′ sequencing primer: mCherry-F

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry