pCVL.Active/Repressed TLR (Sce)
(Plasmid #45575)

• Purpose: Codes for the Active/Repressed TLR with the target site for I-Sce I nuclease
• Depositing Lab: Andrew Scharenberg
• Publication: Kuhar et al Nucleic Acids Res. 2013 Oct 10.

Backbone

• Vector backbone: pCVL
• Backbone size w/o insert (bp): 4483
• Total vector size (bp): 8155
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: eGFP with I-Sce I TS
• Species: H. sapiens (human)
• Insert Size (bp): 759
• Mutation: embedded I-Sce I TS from 163-185
• Promoter: SFFV
• Tags / Fusion Proteins:
  • iRFP (N terminal on insert)
  • T2A dislinker (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: SFFVpro-F (CTTCTGCTTCCCGAGCTCTA)
• 3′ sequencing primer: mCherry-R

Gene/Insert 2

• Gene/Insert name: +3 mCherry
• Insert Size (bp): 708

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: EGFP-C
• 3′ sequencing primer: WPRE-R

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry