pcDNA5/FRT-HA-rM3D(Gs)
(Plasmid #45549)

• Depositing Lab: Bryan Roth
• Publication: Armbruster et al Proc Natl Acad Sci U S A. 2007 Mar 20;104(12):5163-8. Epub 2007 Mar 2.

Backbone

• Vector backbone: pcDNA5/FRT
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5026
• Total vector size (bp): 6441
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HA-rM3D
• Alt name: HA-GsD
• Species: R. norvegicus (rat)
• Insert Size (bp): 1415
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: cctcgactgtgccttcta

Resource Information

• Supplemental Documents:
  • Detailed information on this plasmid from Roth lab
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.