Skip to main content
Addgene

pcDNA5/FRT-HA-rM3D(Gs)
(Plasmid #45549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45549 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA5/FRT
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5026
  • Total vector size (bp) 6441
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rM3D (Gs)
  • Alt name
    HA-GsD
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1415
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer cctcgactgtgccttcta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT-HA-rM3D(Gs) was a gift from Bryan Roth (Addgene plasmid # 45549 ; http://n2t.net/addgene:45549 ; RRID:Addgene_45549)
  • For your References section:

    Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand. Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL. Proc Natl Acad Sci U S A. 2007 Mar 20;104(12):5163-8. Epub 2007 Mar 2. 10.1073/pnas.0700293104 PubMed 17360345