pcDNA3.1+/mit-2mutAEQ
(Plasmid #45539)

• Depositing Lab: Javier Alvarez-Martin
• Publication: de la Fuente et al Biochem J. 2012 Aug 1;445(3):371-6. doi: 10.1042/BJ20120423.

Backbone

• Vector backbone: pcDNA3.1+
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5300
• Total vector size (bp): 6230
• Vector type: Mammalian Expression
• Selectable markers: G418

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mit-2mutAEQ
• Alt name: Mitochondrially targeted 28,119-double mutated Aequorin
• Species: jellyfish
• Insert Size (bp): 950
• Mutation: Asp119Ala and Asn28Leu
• Tag / Fusion Protein:
  • Mitochondrially targeted (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GAATTCGGCTACGGCTGACCGTTT

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that numbering of the aequorin mutations in this plasmid is relative to the valine at position 8 in the original sequence from Inouye et al., PNAS 82, 3154 (1985) PubMed ID: 3858813. When compared to this sequence (GenBank ID AAA27720.1) the mutations at N28L and D119A would correspond to N35L and D126A.