Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1+/mit-2mutAEQ
(Plasmid #45539)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1+
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5300
  • Total vector size (bp) 6230
  • Vector type
    Mammalian Expression
  • Selectable markers
    G418

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mit-2mutAEQ
  • Alt name
    Mitochondrially targeted 28,119-double mutated Aequorin
  • Species
    jellyfish
  • Insert Size (bp)
    950
  • Mutation
    Asp119Ala and Asn28Leu
  • Tag / Fusion Protein
    • Mitochondrially targeted (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GAATTCGGCTACGGCTGACCGTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that numbering of the aequorin mutations in this plasmid is relative to the valine at position 8 in the original sequence from Inouye et al., PNAS 82, 3154 (1985) PubMed ID: 3858813. When compared to this sequence (GenBank ID AAA27720.1) the mutations at N28L and D119A would correspond to N35L and D126A.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1+/mit-2mutAEQ was a gift from Javier Alvarez-Martin (Addgene plasmid # 45539 ; http://n2t.net/addgene:45539 ; RRID:Addgene_45539)
  • For your References section:

    Mitochondrial free [Ca(2+)] dynamics measured with a novel low-Ca(2+) affinity aequorin probe. de la Fuente S, Fonteriz RI, de la Cruz PJ, Montero M, Alvarez J. Biochem J. 2012 Aug 1;445(3):371-6. doi: 10.1042/BJ20120423. 10.1042/BJ20120423 PubMed 22671130