pCMV-Kl-EGFP
(Plasmid #45532)

• Depositing Lab: Zipora Yablonka-Reuveni
• Publication: Phelps et al FEBS J. 2016 May;283(9):1653-68. doi: 10.1111/febs.13682. Epub 2016 Apr 13.

Backbone

• Vector backbone: pCR3
• Backbone size w/o insert (bp): 5710
• Total vector size (bp): 8760
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: alpha Klotho
• Alt name: Kl
• Species: M. musculus (mouse)
• Insert Size (bp): 3050
• GenBank ID: NM_013823
• Entrez Gene: Kl (a.k.a. alpha-kl)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: cgtcgccgtccagctcgaccag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This plasmid was developed by Michael Phelps during his postdoctoral research at the Yablonka-Reuveni lab.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry