Tol2 Krt4 Src (YF)-uniRapR-cerulean
(Plasmid #45509)

• Depositing Labs: Klaus Hahn, Anna Huttenlocher
• Publication: Dagliyan et al Proc Natl Acad Sci U S A. 2013 Apr 23;110(17):6800-4. doi: 10.1073/pnas.1218319110. Epub 2013 Apr 8.

Backbone

• Vector backbone: pT2KHspGGFF (Asakawa K, Kawakami K. Dev Growth Differ. 2008)
• Backbone size w/o insert (bp): 9773
• Total vector size (bp): 13668
• Modifications to backbone: T2:Krt4: Src-iFKB-cpFRB-Cer-Myc was constructed by first removing the heat shock promoter from pT2KHspGGFF (Asakawa K, Kawakami K. Dev Growth Differ. 2008) via a ApaI/NcoI digest and replacing it with a ApaI/NcoI fragment containing the Krt4 promoter (Ju B et al. Dev Genet. 1999, Gong et al. 2002. Dev Dyn, genebank GenBank: AF440690.1) which was amplified with (Apa-Krt4 GATGGGCCCCTACAGTAAAGCTTCTCCACAATGTCCCG and NcoI-Krt4 CTACCATGGCTCTGCGTGTCTCTCAGCAGC). Next the GFP-Gal4 fragment was removed with a NcoI/SmaI digest and replaced with the cassette containing Src-iFKB-cpFRB-Cer-Myc which had been removed from PUse via a NcoI/SnaI digest. The final T2:Krt4: Src-iFKB-cpFRB-Cer-Myc contains the Krt4 promoter, the Src-iFKB-cpFRB-Cer-Myc cassette and the polyA signal between Tol2 sequences.
• Vector type: zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Src (YF)-uniRapR-cerulean
• Insert Size (bp): 2988
• Mutation: Y732F
• Promoter: krt4
• Tag / Fusion Protein:
  • cerulean (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: Snab1 (destroyed during cloning)
• 5′ sequencing primer: CAAGGGTTGCCATCAAAACT
• 3′ sequencing primer: AAGTCGTGCTGCTTCATGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results differ from the full plasmid sequence information from the depositing laboratory at bp# 3150, 3188, 3193, 3199, 3211, 3227, 3307, 5577 & 5578. These differences are not a concern for the function of the plasmid according to the depositing laboratory.