pCELF PAI-RBP v2
(Plasmid #45505)

• Depositing Lab: Thomas Gelehrter
• Publication: Heaton et al J Biol Chem. 2001 Feb 2;276(5):3341-7. Epub 2000 Sep 22.

Backbone

• Vector backbone: pCEFL
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 7200
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PAI-RBP v2
• Alt name: Plasminogen activator inhibitor type 1 RNA binding protein variant 2
• Species: H. sapiens (human), R. norvegicus (rat)
• Insert Size (bp): 1200
• GenBank ID:
• Entrez Gene: SERBP1 (a.k.a. CGI-55, CHD3IP, HABP4L, PAI-RBP1, PAIRBP1)
• Tag / Fusion Protein:
  • GST tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: TTCTTCCATTTCAGGTGTCG information from Addgene
• 3′ sequencing primer: SP6 information from Addgene

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Resource Center and Primary Database of the German Human Genome Project

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Our lab isolated the protein based on it's ability to bind to a region of the PAI-1 (plasminogen activator inhibitor type 1) 3'UTR that we had determined to be involved in the cAMP regulation of mRNA stability. A search of the database revealed that the cDNA for the protein had been cloned by the German Genome Project and dubbed hypothetical protein. They kindly provided us with the clone, which we subcloned into pET-15b for expression of the protein and then into CMV-Flag for mammalian expression.
Subsequently, we discovered isoforms of the protein with or without 6 and/or 15 amino acid insertions. Variant 2 has the 6 amino acid insertion but lacks the 15 amino acid insertion.
Additional reference: Heaton, JH et al 2003 Thromb Haemost 89; 959-966.