pR6Kcat-rdxA-rpsL
(Plasmid #45471)

• Depositing Lab: Michele Swanson
• Publication: Bryan et al Mol Microbiol. 2011 Apr;80(1):231-47. doi: 10.1111/j.1365-2958.2011.07573.x. Epub 2011 Feb 24.

Backbone

• Vector backbone: pR6K
• Total vector size (bp): 2730
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): HB101 lambda pir
• Growth instructions: Pick the smaller colonies.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: cat-rdxA-rpsL
• Alt name: MB 776

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: R6K-3'
• 3′ sequencing primer: ttaagccttaggacgcttcacg

Resource Information

• Supplemental Documents:
  • genbank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Full cassette consists of: NotI-SpeI-SexAI-EcoRI-cat-rdxA-rpsL-EcoRI-NotI-ClaI-BamHI-NotI.

Cassette gives slightly smaller slower growing colonies--use the small ones for the strongest counter-selection as big ones may have accumulated point mutations. For counter selection, use fresh plates.

This construct is sensitive to metronidazole and streptomycin.