Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCI-EGFP-NR2b wt
(Plasmid #45447)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45447 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4006
  • Total vector size (bp) 9695
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Growth instructions
    Note: This plasmid causes extremely slow growth. The depositing lab notes that growth times longer than the standard growth period may be required.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NR2B
  • Alt name
    NMDAR2B
  • Alt name
    Grin2b
  • Alt name
    GluN2B
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    5700
  • Mutation
    EGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 31)
  • GenBank ID
  • Entrez Gene
    Grin2b (a.k.a. GluN2B)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Rat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene Next-generation sequencing identified a sequence discrepancy that results in a Met to Leu change at position 745 in the plasmid insert, relative to Genbank IDs NM_012574.1 and NP_036706.1. The plasmid is expected to function as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-EGFP-NR2b wt was a gift from Andres Barria & Robert Malinow (Addgene plasmid # 45447 ; http://n2t.net/addgene:45447 ; RRID:Addgene_45447)
  • For your References section:

    Subunit-specific NMDA receptor trafficking to synapses. Barria A, Malinow R. Neuron. 2002 Jul 18;35(2):345-53. 10.1016/S0896-6273(02)00776-6 PubMed 12160751