pCI-EGFP-NR2b wt
(Plasmid #45447)

• Depositing Labs: Andres Barria, Robert Malinow
• Publication: Barria et al Neuron. 2002 Jul 18;35(2):345-53.

Backbone

• Vector backbone: pCI
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4006
• Total vector size (bp): 9695
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Growth instructions: Note: This plasmid causes extremely slow growth. The depositing lab notes that growth times longer than the standard growth period may be required.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: NR2B
• Alt name: NMDAR2B
• Alt name: Grin2b
• Alt name: GluN2B
• Species: R. norvegicus (rat)
• Insert Size (bp): 5700
• Mutation: EGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 31)
• GenBank ID:
• Entrez Gene: Grin2b (a.k.a. GluN2B)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (destroyed during cloning)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
• 3′ sequencing primer: EBV-rev

Resource Information

• Supplemental Documents:
  • pCI GFPNMDAR2bwt genbank file
• A portion of this plasmid was derived from a plasmid made by: Rat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene Next-generation sequencing identified a sequence discrepancy that results in a Met to Leu change at position 745 in the plasmid insert, relative to Genbank IDs NM_012574.1 and NP_036706.1. The plasmid is expected to function as described in the associated publication.