pCI-EGFP-NR1 wt
(Plasmid #45446)

• Depositing Labs: Andres Barria, Robert Malinow
• Publication: Barria et al Neuron. 2002 Jul 18;35(2):345-53.

Backbone

• Vector backbone: pCI
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4006
• Total vector size (bp): 8996
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NR1
• Alt name: NMDAR1
• Alt name: Grin1
• Alt name: GluN1
• Species: R. norvegicus (rat)
• Insert Size (bp): 5000
• Mutation: EGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 26)
• GenBank ID:
• Entrez Gene: Grin1 (a.k.a. GluN1, NMDAR1, NR1)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
• 3′ sequencing primer: EBV-rev

Resource Information

• Supplemental Documents:
  • genbank file
• A portion of this plasmid was derived from a plasmid made by: Rat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry