pCI-EGFP-NR2a wt
(Plasmid #45445)

• Depositing Labs: Andres Barria, Robert Malinow
• Publication: Barria et al Neuron. 2002 Jul 18;35(2):345-53.

Backbone

• Vector backbone: pCI
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4006
• Total vector size (bp): 10031
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NR2A
• Alt name: NMDAR2A
• Alt name: GRIN2a
• Alt name: GluN2a
• Species: R. norvegicus (rat)
• Insert Size (bp): 6000
• Mutation: EGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 21)
• GenBank ID: D13211.1 BAA02498.1
• Entrez Gene: Grin2a (a.k.a. GluN2A, NMDAR2A, NR2A)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (destroyed during cloning)
• 3′ cloning site: SalI (destroyed during cloning)
• 5′ sequencing primer: T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
• 3′ sequencing primer: EBV-rev

Resource Information

• Supplemental Documents:
  • genbank file
• A portion of this plasmid was derived from a plasmid made by: Rat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry