TRS6E1b-luc(-732/-721) mutant 5
(Plasmid #45388)

• Depositing Lab: Thomas Gelehrter
• Publication: Song et al J Biol Chem. 1998 Nov 6;273(45):29287-90.

Backbone

• Vector backbone: pGL2 basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5700
• Modifications to backbone: E1bTATA inserted upstream of luciferase
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 6 copies of hPAI-1 promoter -732/-721 mutated at -725/723
• Alt name: TRS6 m5
• Species: H. sapiens (human)
• Insert Size (bp): 72
• Mutation: -725/-723 mutated from gtt to ccc
• Tag / Fusion Protein:
  • luciferase

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: Hind III (not destroyed)
• 5′ sequencing primer: TGTATCTTATGGTACTGTAACTG from Promega
• 3′ sequencing primer: CTTTATGTTTTTGGCGTCTTCCA from Promega

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry