pMP44-1
(Plasmid
#45364)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFLAG-CMV2
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMAVS
-
SpeciesPongo pygmaeus pygmaeus (Bornean orangutan)
-
Insert Size (bp)1623
-
GenBank IDKC415011.1
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer gacgcaaatgggcggtaggcgtg
- 3′ sequencing primer gacaaggctggtgggcactggag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMP44-1 was a gift from Harmit Malik (Addgene plasmid # 45364 ; http://n2t.net/addgene:45364 ; RRID:Addgene_45364) -
For your References section:
Convergent evolution of escape from hepaciviral antagonism in primates. Patel MR, Loo YM, Horner SM, Gale M Jr, Malik HS. PLoS Biol. 2012;10(3):e1001282. doi: 10.1371/journal.pbio.1001282. Epub 2012 Mar 13. 10.1371/journal.pbio.1001282 PubMed 22427742