mpx:UtrCH-GFP
(Plasmid #45247)

• Depositing Lab: Anna Huttenlocher
• Publication: Yoo et al Dev Cell. 2010 Feb 16. 18(2):226-36.

Backbone

• Vector backbone: tol2:mpx-gfp
• Backbone size w/o insert (bp): 12500
• Total vector size (bp): 13442
• Modifications to backbone: inserted utrophin
• Vector type: zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: utrophin
• Species: H. sapiens (human)
• Insert Size (bp): 700
• Mutation: contains amino acids 1-261 of NP_009055.2; Q236R
• Entrez Gene: UTRN (a.k.a. DMDL, DRP, DRP1)
• Promoter: mpx
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NcoI (not destroyed)
• 5′ sequencing primer: TAGGGATCCGGTAGGCGTGTA
• 3′ sequencing primer: tgaacagctcctcgccctt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: the original plasmid is a generous gift from W. Bement(Burkel et al., 2007)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry