Tol2-mpx:Lifeact-Ruby
(Plasmid #45246)

• Depositing Lab: Anna Huttenlocher
• Publication: Yoo et al Dev Cell. 2010 Feb 16. 18(2):226-36.

Backbone

• Vector backbone: tol2-mpx
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 12600
• Modifications to backbone: added pRuby tagged LifeAct
• Vector type: zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: lifeact-ruby
• Promoter: mpx

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: bamHI (destroyed during cloning)
• 3′ cloning site: salI (not destroyed)
• 5′ sequencing primer: ccaggtcattgcacaacaccag
• 3′ sequencing primer: gttatccgctcacaattccacac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: the original plasmid is a generous gift from M. Sixt
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results differ from the full plasmid sequence information from the depositing laboratory at bp# 9886. This difference is in the vector backbone and is not a concern for the function of the plasmid according to the depositing laboratory.