Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Tol2-mpx:Lifeact-Ruby
(Plasmid #45246)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45246 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    tol2-mpx
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 12600
  • Modifications to backbone
    added pRuby tagged LifeAct
  • Vector type
    zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    lifeact-ruby
  • Promoter mpx

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site bamHI (destroyed during cloning)
  • 3′ cloning site salI (not destroyed)
  • 5′ sequencing primer ccaggtcattgcacaacaccag
  • 3′ sequencing primer gttatccgctcacaattccacac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the original plasmid is a generous gift from M. Sixt
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing results differ from the full plasmid sequence information from the depositing laboratory at bp# 9886. This difference is in the vector backbone and is not a concern for the function of the plasmid according to the depositing laboratory.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-mpx:Lifeact-Ruby was a gift from Anna Huttenlocher (Addgene plasmid # 45246 ; http://n2t.net/addgene:45246 ; RRID:Addgene_45246)
  • For your References section:

    Differential regulation of protrusion and polarity by PI3K during neutrophil motility in live zebrafish. Yoo SK, Deng Q, Cavnar PJ, Wu YI, Hahn KM, Huttenlocher A. Dev Cell. 2010 Feb 16. 18(2):226-36. 10.1016/j.devcel.2009.11.015 PubMed 20159593