Skip to main content
Addgene

pBLIC-neo
(Plasmid #45198)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45198 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBABE
  • Backbone size (bp) 5320
  • Modifications to backbone
    Ligation-independent cloning (LIC) adaptor added to pBABE cloning site: GCACACCATCTCACGTGGAATGTGAG CGTGTGGTAGAGTGCACCTTACACTC
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pBABE 5'
  • 3′ sequencing primer pBABE 3'
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBLIC-neo was a gift from Priyamvada Rai (Addgene plasmid # 45198 ; http://n2t.net/addgene:45198 ; RRID:Addgene_45198)

  • For your References section:

    Creation and validation of a ligation-independent cloning (LIC) retroviral vector for stable gene transduction in mammalian cells. Patel A, Munoz A, Halvorsen K, Rai P. BMC Biotechnol. 2012 Jan 16;12:3. doi: 10.1186/1472-6750-12-3. 10.1186/1472-6750-12-3 PubMed 22248071
Related items:
Commonly requested with: