pLenti-Arch-EEN
(Plasmid #45189)

• Purpose: Arch voltage indicator with double mutations D95N-D106E (Arch-EEN), with faster kinetics and greater fluorescence dynamic range than Arch-D95N
• Depositing Lab: Mark Schnitzer
• Publication: Gong et al PLoS One. 2013 Jun 19;8(6):e66959.

Backbone

• Vector backbone: pLenti
• Backbone size w/o insert (bp): 9239
• Total vector size (bp): 10793
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: enhanced Archaerhodopsin-3
• Alt name: Arch-EEN
• Species: H. sodomense
• Insert Size (bp): 1554
• Mutation: D95N, D106E
• Promoter: CamKIIa
• Tag / Fusion Protein:
  • eYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ctgacgaaggctcgcgaggc
• 3′ sequencing primer: gccatacgggaagcaatagcatg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Deisseroth lab: Plasmid 35514: pLenti-CaMKIIa-eArch 3.0-EYFP

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there may be several sequence discrepancies between depositor's reference sequence and Addgene's quality control sequence which are consistant with the discrepancies in plasmid 35514. These changes are in vector regions only and should not affect plasmid function.