pEYFP-C1-Drp1
(Plasmid #45160)

• Depositing Lab: Richard Youle
• Publication: Frank et al Dev Cell. 2001 Oct;1(4):515-25.

Backbone

• Vector backbone: pEYFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4706
• Total vector size (bp): 6806
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Drp1
• Alt name: Dynamin related protein 1
• Alt name: DNM1L
• Alt name: DLP1
• Species: H. sapiens (human)
• Insert Size (bp): 2100
• GenBank ID: NM_005690
• Entrez Gene: DNM1L (a.k.a. DLP1, DRP1, DVLP, DYMPLE, EMPF, EMPF1, HDYNIV, OPA5)
• Promoter: CMV
• Tag / Fusion Protein:
  • EYFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcorI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: AGAAGCGCGATCACATGG
• 3′ sequencing primer: CTACAAATGTGGTATGGCTG

Resource Information

• Articles Citing this Plasmid:
  • 16 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry