pETCON-HtsptLB12v.3
(Plasmid
#45121)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepETCON
- Backbone size w/o insert (bp) 6287
- Total vector size (bp) 6767
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHtsptLB12v.3
-
SpeciesSynthetic
-
Insert Size (bp)480
- Promoter GAL
-
Tags
/ Fusion Proteins
- c-myc epitope tag (C terminal on backbone)
- Aga2p for yeast surface display (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer None
- 3′ sequencing primer cgagctaaaagtacagtggg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETCON-HtsptLB12v.3 was a gift from David Baker (Addgene plasmid # 45121 ; http://n2t.net/addgene:45121 ; RRID:Addgene_45121) -
For your References section:
Computational design of a protein-based enzyme inhibitor. Procko E, Hedman R, Hamilton K, Seetharaman J, Fleishman SJ, Su M, Aramini J, Kornhaber G, Hunt JF, Tong L, Montelione GT, Baker D. J Mol Biol. 2013 Sep 23;425(18):3563-75. doi: 10.1016/j.jmb.2013.06.035. 10.1016/j.jmb.2013.06.035 PubMed 23827138
