pRSV-PKImut-v2
(Plasmid #45067)

• Purpose: Expression of intactive PKI (PKA inhibitor) mutant
• Depositing Lab: Richard Maurer
• Publication: RSV-PKI (unpublished)

Backbone

• Vector backbone: pRSV-link
• Backbone manufacturer: Maurer lab
• Backbone size w/o insert (bp): 4265
• Total vector size (bp): 4517
• Modifications to backbone: Backbone derived from pRSV-globin
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cAMP-dependent protein kinase inhibitor alpha
• Alt name: PKI alpha
• Species: Synthetic
• Insert Size (bp): 250
• Mutation: changed Arg 20 & 21 to Glycines
• GenBank ID: M23079.1
• Promoter: RSV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGATACAATAAACGCCATTTGA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Derived from RSV-PKI constructed by the Maurer lab and described in Day et al., J. Biol. Chem. 264, 431-436, 1989. Altered to add a Kozak consensus translation initiation sequence and also the ori was changed to yield high copy number in E coli.