Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRSV-PKImut-v2
(Plasmid #45067)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45067 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRSV-link
  • Backbone manufacturer
    Maurer lab
  • Backbone size w/o insert (bp) 4265
  • Total vector size (bp) 4517
  • Modifications to backbone
    Backbone derived from pRSV-globin
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cAMP-dependent protein kinase inhibitor alpha
  • Alt name
    PKI alpha
  • Species
    Synthetic
  • Insert Size (bp)
    250
  • Mutation
    changed Arg 20 & 21 to Glycines
  • GenBank ID
    M23079.1
  • Promoter RSV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGATACAATAAACGCCATTTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Derived from RSV-PKI constructed by the Maurer lab and described in Day et al., J. Biol. Chem. 264, 431-436, 1989. Altered to add a Kozak consensus translation initiation sequence and also the ori was changed to yield high copy number in E coli.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSV-PKImut-v2 was a gift from Richard Maurer (Addgene plasmid # 45067 ; http://n2t.net/addgene:45067 ; RRID:Addgene_45067)