-
PurposeExpression of constit active CaMKII
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSV-link
-
Backbone manufacturerMaurer lab
- Backbone size w/o insert (bp) 4265
- Total vector size (bp) 5729
-
Modifications to backboneBackbone derived from pRSV-globin
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCaM Kinase II
-
Alt namecamk2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)892
-
Mutationtruncated at amino acid 290
-
GenBank IDNM_012920.1
-
Entrez GeneCamk2a (a.k.a. PK2CDD, PKCCD)
- Promoter RSV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site Bgl II (destroyed during cloning)
- 5′ sequencing primer CGATACAATAAACGCCATTTGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSV-CaMKII(1-290) was a gift from Richard Maurer (Addgene plasmid # 45065 ; http://n2t.net/addgene:45065 ; RRID:Addgene_45065) -
For your References section:
Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Sun P, Enslen H, Myung PS, Maurer RA. Genes Dev. 1994 Nov 1;8(21):2527-39. 10.1101/gad.8.21.2527 PubMed 7958915