pRSV-CaMKIV(1-313)
(Plasmid #45063)

• Purpose: Expression of constit active CaMKIV
• Depositing Lab: Richard Maurer
• Publication: Sun et al Genes Dev. 1994 Nov 1;8(21):2527-39.

Backbone

• Vector backbone: pRSV-link
• Backbone manufacturer: Maurer lab
• Backbone size w/o insert (bp): 4265
• Total vector size (bp): 5193
• Modifications to backbone: Backbone derived from pRSV-globin
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cam Kinase IV(1-313)
• Alt name: camk4(1-313)
• Species: M. musculus (mouse)
• Insert Size (bp): 30
• Mutation: truncated at amino acid 313*
• GenBank ID: NM_009793.3
• Entrez Gene: Camk4 (a.k.a. A430110E23Rik, AI666733, CaM, CaMKI, CaMKIV, CaMKIV/Gr, D18Bwg0362e)
• Promoter: RSV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: Bgl II (not destroyed)
• 5′ sequencing primer: CGATACAATAAACGCCATTTGA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This CaMKIV has a R128A mutation. The depositor considers this a polymorphism that is not functionally relevant.