-
PurposeExpression of CaMKIV
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45062 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSV-link
-
Backbone manufacturerMaurer lab
- Backbone size w/o insert (bp) 4265
- Total vector size (bp) 5675
-
Modifications to backboneBackbone derived from pRSV-globin
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCam Kinase IV
-
Alt namecamk4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1410
-
Mutation*
-
GenBank IDNM_009793.3
-
Entrez GeneCamk4 (a.k.a. A430110E23Rik, AI666733, CaM, CaMKI, CaMKIV, CaMKIV/Gr, D18Bwg0362e)
- Promoter RSV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGATACAATAAACGCCATTTGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
*This CaMKIV has a R128A mutation. The depositor considers this a polymorphism that is not functionally relevant.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSV-CaMKIV was a gift from Richard Maurer (Addgene plasmid # 45062 ; http://n2t.net/addgene:45062 ; RRID:Addgene_45062) -
For your References section:
Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Sun P, Enslen H, Myung PS, Maurer RA. Genes Dev. 1994 Nov 1;8(21):2527-39. 10.1101/gad.8.21.2527 PubMed 7958915