pBa.NgCam.GFP
(Plasmid #45061)

• Depositing Labs: Gary Banker, Marvin Bentley
• Publication: Burack et al Neuron. 2000 May;26(2):465-72.

Backbone

• Vector backbone: pBa-eGFP
• Backbone size w/o insert (bp): 6755
• Total vector size (bp): 10579
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NgCam
• Alt name: Neuron-glia cell adhesion molecule (Ng-CAM)
• Species: G. gallus (chicken)
• Insert Size (bp): 3839
• GenBank ID: Z75013
• Entrez Gene: L1CAM
• Promoter: Chicken Beta Actin
• Tag / Fusion Protein:
  • eGFP (C terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGAC
• 3′ sequencing primer: GTGGTTTGTCCAAACTCATC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: NgCam received from Peter Sonderegger

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NgCam is very GC rich and difficult to sequence and PCR.

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

Addgene's sequencing results found a few nucleotide differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositor, these differences are not a concern for the function of the plasmid.