pBa.TfR.GFP
(Plasmid #45060)

• Depositing Labs: Gary Banker, Marvin Bentley
• Publication: Burack et al Neuron. 2000 May;26(2):465-72.

Backbone

• Vector backbone: pBa-eGFP
• Backbone size w/o insert (bp): 6755
• Total vector size (bp): 9031
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TfR
• Alt name: human transferrin receptor
• Species: H. sapiens (human)
• Insert Size (bp): 2276
• GenBank ID: M11507
• Entrez Gene: TFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
• Promoter: Chicken Beta Actin
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGAC
• 3′ sequencing primer: GTGGTTTGTCCAAACTCATC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Kif 5c received from Caroine Enns, Oregon Health & Science University
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.