-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45058 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBa-eGFP
- Backbone size w/o insert (bp) 6755
- Total vector size (bp) 7924
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKif 1a
-
Alt namekinesin family member 1A
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1187
-
Mutationmotor domain aa 1-396
-
GenBank ID
-
Entrez GeneKif1a
- Promoter Chicken Beta Actin
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKif 1A received from Bruce Schnapp, Oregon Health & Science University
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBa.Kif1a 1-396.GFP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 45058 ; http://n2t.net/addgene:45058 ; RRID:Addgene_45058) -
For your References section:
A change in the selective translocation of the Kinesin-1 motor domain marks the initial specification of the axon. Jacobson C, Schnapp B, Banker GA. Neuron. 2006 Mar 16;49(6):797-804. 10.1016/j.neuron.2006.02.005 PubMed 16543128