Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEN-MCS
(Plasmid #44919)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44919 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEN
  • Backbone size (bp) 5160
  • Modifications to backbone
    added multiple cloning site
  • Vector type
    stable complementation
  • Promoter none

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGCACTTGCTCACGCTCTG
  • 3′ sequencing primer gtggtcacgcttttcgttgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    James Galen University of Maryland

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

original source is pGEN222

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEN-MCS was a gift from Harry Mobley (Addgene plasmid # 44919 ; http://n2t.net/addgene:44919 ; RRID:Addgene_44919)
  • For your References section:

    Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Lane MC, Alteri CJ, Smith SN, Mobley HL. Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16669-74. Epub 2007 Oct 9. 10.1073/pnas.0607898104 PubMed 17925449