Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCHA-VRC01-scFv
(Plasmid #44874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44874 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCHA
  • Backbone size w/o insert (bp) 6096
  • Total vector size (bp) 6873
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VRC01 scFv
  • Insert Size (bp)
    777
  • Promoter GAL1
  • Tags / Fusion Proteins
    • HA (N terminal on backbone)
    • Myc (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CTGGGGTAATTAATCAGCGAAGCG
  • 3′ sequencing primer CATGGGAAAACATGTTGTTTACGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCHA-VRC01-scFv was a gift from Dane Wittrup (Addgene plasmid # 44874 ; http://n2t.net/addgene:44874 ; RRID:Addgene_44874)
  • For your References section:

    Rapid conformational epitope mapping of anti-gp120 antibodies with a designed mutant panel displayed on yeast. Mata-Fink J, Kriegsman B, Yu HX, Zhu H, Hanson MC, Irvine DJ, Wittrup KD. J Mol Biol. 2013 Jan 23;425(2):444-56. doi: 10.1016/j.jmb.2012.11.010. Epub 2012 Nov 15. 10.1016/j.jmb.2012.11.010 PubMed 23159556