pTK023
(Plasmid
#44860)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTK021
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameADH4-PURA3-URA3-G8-yEGFP1-CLN2PD-NLSSV40-TURA3-TG
-
SpeciesS. cerevisiae (budding yeast)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer AAAAATCGAACGAACTCATAAACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK023 was a gift from Michael Grunstein (Addgene plasmid # 44860 ; http://n2t.net/addgene:44860 ; RRID:Addgene_44860) -
For your References section:
Mechanism for epigenetic variegation of gene expression at yeast telomeric heterochromatin. Kitada T, Kuryan BG, Tran NN, Song C, Xue Y, Carey M, Grunstein M. Genes Dev. 2012 Nov 1;26(21):2443-55. doi: 10.1101/gad.201095.112. 10.1101/gad.201095.112 PubMed 23124068