pDONR207-SD3(1-50)
(Plasmid
#44587)
-
PurposeGateway entry vector for N-terminal fragment (1-50) of SD3 protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44587 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDONR207
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3373
- Total vector size (bp) 3523
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSD3(1-50)
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)150
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCTC
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR207-SD3(1-50) was a gift from Yutaka Kodama (Addgene plasmid # 44587 ; http://n2t.net/addgene:44587 ; RRID:Addgene_44587) -
For your References section:
Cold-induced organelle relocation in the liverwort Marchantia polymorpha L. Ogasawara Y, Ishizaki K, Kohchi T, Kodama Y. Plant Cell Environ. 2013 Feb 20. doi: 10.1111/pce.12085. 10.1111/pce.12085 PubMed 23421791