pDN-T2dMFot
(Plasmid #44558)

• Depositing Lab: Gabor Balazsi
• Publication: Nevozhay et al PLoS Comput Biol. 2012;8(4):e1002480. doi: 10.1371/journal.pcbi.1002480. Epub 2012 Apr 12.

Backbone

• Vector backbone: pRS404
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4274
• Total vector size (bp): 5320
• Modifications to backbone: CYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites).
• Vector type: Yeast Expression, Synthetic Biology ; Expression regulator/reporter
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PTETREG promoter
• Alt name: Yeast ADH1 transcriptional term. and two copies of the tetO2 operator site upstream of the PCYC1 TATA box and minimal promoter
• Alt name: rtTA-MF inducible promoter
• Species: Synthetic
• Insert Size (bp): 504
• Promoter: PTETREG

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: F1ori-R (AGGGAAGAAAGCGAAAGGAG)
• 3′ sequencing primer: Tet-R (GGCGAGTTTACGGGTTGTTA)

Gene/Insert 2

• Gene/Insert name: rtetR-M2::FFF
• Alt name: modified rtTA transactivator (rtTA-MF)
• Alt name: rtetR-M2 transactivator variant augmented with the short FFF activation domain
• Alt name: Three VP16-derived "F-type" minimal acidic activation domains
• Species: Synthetic; E. Coli
• Insert Size (bp): 750
• Mutation: Compared to rtTA, rtTA-M2 has S12G, E19G, A56P, D148E, and H179R

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TetR-F1 (TTGATCACCAAGGTGCAGAG)

Resource Information

• Supplemental Documents:
  • pDN-T2dMFot.PDW
• A portion of this plasmid was derived from a plasmid made by: PTETREG promoter from plasmid pBB247 from Attila Becskei and Luis Serrano, EMBL Heidelberg, Germany. Modified Tet transactivator rtetR-M2 from plasmid pCM190-M2 from Wolfgang Hiller, Friedrich-Alexander-Universität Erlangen-Nürnberg, Germany. VP16-derived "F-type" minimal acidic activation domain described by Hermann Bujard, ZMBH, Heidelberg, Germany.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry