pDN-T2dGZmxh
(Plasmid #44552)

• Depositing Lab: Gabor Balazsi
• Publication: Nevozhay et al PLoS Comput Biol. 2012;8(4):e1002480. doi: 10.1371/journal.pcbi.1002480. Epub 2012 Apr 12.

Backbone

• Vector backbone: pRS403
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4456
• Total vector size (bp): 5941
• Modifications to backbone: CYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites). Small region of additional homology to the his3 locus inserted in front of the HIS3 gene (between AhdI and AfeI sites) to facilitate integration.
• Vector type: Yeast Expression, Synthetic Biology ; Expression regulator/reporter
• Selectable markers: Zeocin, HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PTETREG promoter
• Alt name: Yeast ADH1 transcriptional term. and two copies of the tetO2 operator site upstream of the PCYC1 TATA box and minimal promoter
• Alt name: rtTA-MF inducible promoter
• Species: Synthetic
• Insert Size (bp): 504
• Promoter: PTETREG

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: F1ori-R (AGGGAAGAAAGCGAAAGGAG)
• 3′ sequencing primer: GFP-R

Gene/Insert 2

• Gene/Insert name: yEGFP::ZeoR
• Alt name: yeast-enhanced green fluorescent protein
• Alt name: Bleomycin/Zeocin resistance protein
• Species: S. cerevisiae (budding yeast), Synthetic
• Insert Size (bp): 1111

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: Zeo-R (ctgatgaacagggtcacgtc)

Resource Information

• Supplemental Documents:
  • pDN-T2dGZmxh.PDW
• A portion of this plasmid was derived from a plasmid made by: PTETREG promoter from plasmid pBB247 from Attila Becskei and Luis Serrano, EMBL Heidelberg, Germany

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmids was created as follows. First, the PTETREG promoter consisting of two tetO2 sites upstream of the minimal PCYC1 promoter was amplified from the pBB247 plasmid (Becskei, Séraphin, and Serrano, EMBO 2001, PMID: 11350942), and inserted into the pDN-G1GZmh plasmid between the AflII and BamHI sites instead of the PGAL1-D12 promoter resulting in the pDN-T2dGZmh plasmid. In order to facilitate the planned integration of the reporter plasmid into the his3Δ200 locus of the YPH500 strain, a small region bearing homology to the his3Δ200 locus was constructed by PCR and inserted in front of the HIS3 gene between the AhdI and AfeI sites of the pDN-T2dGZmh plasmid, resulting in the pDN-T2dGZmlh plasmid. Next, a second ADH1 terminator was removed from the pDN-T2dGZmlh plasmid, resulting in the final reporter pDN-T2dGZmxh plasmid bearing the yEGFP::zeoR fluorescent reporter gene under the control of the PTETREG rtTA-MF inducible promoter.