pPK619
(Plasmid
#44547)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUK499
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehhf2
-
Mutationdel (100-102)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CCTACATCTTGTTCAAAAGAGTAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPK619 was a gift from Michael Grunstein (Addgene plasmid # 44547 ; http://n2t.net/addgene:44547 ; RRID:Addgene_44547) -
For your References section:
Extremely conserved histone H4 N terminus is dispensable for growth but essential for repressing the silent mating loci in yeast. Kayne PS, Kim UJ, Han M, Mullen JR, Yoshizaki F, Grunstein M. Cell. 1988 Oct 7;55(1):27-39. 10.1016/0092-8674(88)90006-2 PubMed 3048701