Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPK609
(Plasmid #44539)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUK499
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hhf2
  • Mutation
    del (83-88)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer CCTACATCTTGTTCAAAAGAGTAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPK609 was a gift from Michael Grunstein (Addgene plasmid # 44539 ; http://n2t.net/addgene:44539 ; RRID:Addgene_44539)
  • For your References section:

    Extremely conserved histone H4 N terminus is dispensable for growth but essential for repressing the silent mating loci in yeast. Kayne PS, Kim UJ, Han M, Mullen JR, Yoshizaki F, Grunstein M. Cell. 1988 Oct 7;55(1):27-39. 10.1016/0092-8674(88)90006-2 PubMed 3048701