pDN-NG1Tt
(Plasmid #44523)

• Depositing Lab: Gabor Balazsi
• Publication: Nevozhay et al Proc Natl Acad Sci U S A. 2009 Mar 31;106(13):5123-8. doi: 10.1073/pnas.0809901106. Epub 2009 Mar 11.

Backbone

• Vector backbone: pRS404
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4274
• Total vector size (bp): 5958
• Modifications to backbone: CYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites). Additional, nonfunctional tetracycline repressor (tetR) fragment present between SacI and SpeI sites.
• Vector type: Yeast Expression, Synthetic Biology ; Expression regulator/reporter
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PGal1 (wt) promoter
• Alt name: Yeast GAL1 promoter
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 450
• Entrez Gene: GAL1 (a.k.a. YBR020W)
• Promoter: PGal1 (wt)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: Gal1ProF2 (CGAAGCGATGATTTTTGATC)
• 3′ sequencing primer: Tet-R (GGCGAGTTTACGGGTTGTTA)

Gene/Insert 2

• Gene/Insert name: tetR
• Alt name: Tetracycline repressor
• Species: Synthetic; E. Coli
• Insert Size (bp): 624

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GAL1

Resource Information

• Supplemental Documents:
  • pDN-NG1Tt.PDW

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry