pDN-G1TCbt
(Plasmid
#44515)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44515 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS404
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4274
- Total vector size (bp) 6483
-
Modifications to backboneCYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites). Additional, nonfunctional tetracycline repressor (tetR) fragment present between SacI and SpeI sites.
-
Vector typeYeast Expression, Synthetic Biology ; Expression regulator/reporter
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePGal1-D12 promoter
-
Alt nameYeast GAL1 promoter with 2XtetO2
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)450
-
MutationTwo tandem tet operators (2XtetO2) downstream of the GAL1 TATA box
-
Entrez GeneGAL1 (a.k.a. YBR020W)
- Promoter PGal1-D12 promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer Gal1ProF2 (CGAAGCGATGATTTTTGATC)
- 3′ sequencing primer Tet-R (GGCGAGTTTACGGGTTGTTA) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametetR::ymcherry
-
Alt nameTetracycline repressor
-
Alt nameyeast-enhanced mcherry fluorescent protein
-
SpeciesS. cerevisiae (budding yeast), Synthetic; E. Coli
-
Insert Size (bp)1385
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GAL1
- 3′ sequencing primer ymcherry-R1 (TGGTAATGGGCCACCCTTAG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDN-G1TCbt was a gift from Gabor Balazsi (Addgene plasmid # 44515 ; http://n2t.net/addgene:44515 ; RRID:Addgene_44515) -
For your References section:
Negative autoregulation linearizes the dose-response and suppresses the heterogeneity of gene expression. Nevozhay D, Adams RM, Murphy KF, Josic K, Balazsi G. Proc Natl Acad Sci U S A. 2009 Mar 31;106(13):5123-8. doi: 10.1073/pnas.0809901106. Epub 2009 Mar 11. 10.1073/pnas.0809901106 PubMed 19279212