-
PurposeA crRNA expression plasmid specific to the rpsL allele.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZE21-MCS1
- Backbone size w/o insert (bp) 2254
- Total vector size (bp) 2433
-
Vector typeCRISPR ; E.coli
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPR::rpsL
-
Entrez GenerpsL (a.k.a. b3342, ECK3329, asuB, strA)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence aaaaaaccgaactccgcgctgcgtaaagta
This plasmid is also known as pDB130.
For more information on Marraffini Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/marraffini/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR::rpsL was a gift from Luciano Marraffini (Addgene plasmid # 44505 ; http://n2t.net/addgene:44505 ; RRID:Addgene_44505) -
For your References section:
RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508. 10.1038/nbt.2508 PubMed 23360965