-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLPCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6300
- Total vector size (bp) 8700
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNotch intracellular domain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2389
-
MutationContains amino acid 1753 to C-Term
-
Entrez GeneNotch1 (a.k.a. 9930111A19Rik, Mis6, N1, Tan1, lin-12)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Jeffrey Nye generated the NICD cDNA. Reference: Development 120, 2421-2430 (1994).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLPCX-NICD was a gift from Ernesto Canalis (Addgene plasmid # 44471 ; http://n2t.net/addgene:44471 ; RRID:Addgene_44471) -
For your References section:
Reciprocal regulation of Notch and nuclear factor of activated T-cells (NFAT) c1 transactivation in osteoblasts. Zanotti S, Smerdel-Ramoya A, Canalis E. J Biol Chem. 2011 Feb 11;286(6):4576-88. doi: 10.1074/jbc.M110.161893. Epub 2010 Dec 3. 10.1074/jbc.M110.161893 PubMed 21131365