pGreenII Tfs-494::LUC
(Plasmid #44467)

• Purpose: Expresses a luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutation
• Depositing Labs: Roger Hellens, Ross Johnson
• Publication: Plasmids to assay for nuclease cleavage in planta (unpublished)

Backbone

• Vector backbone: pGreenII 0579-1 (35S:: LUC)
• Backbone size w/o insert (bp): 5549
• Total vector size (bp): 5625
• Vector type: Luciferase ; Plant Transformation

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: A luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutation
• Alt name: Tfs-494::LUC
• Alt name: (+1) TALEN 494 0579-1
• Insert Size (bp): 76
• Mutation: A disruption was made between the first and second triplet of the luciferase gene
• Promoter: 35S Promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: RAJ-417 (CAACCACGTCTTCAAAGCAAGTG)
• 3′ sequencing primer: RAJ-365 (CCAGGAACCAGGGCGTATCTC)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry