Skip to main content
Addgene

pGreenII Tfs-qqr::LUC
(Plasmid #44466)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44466 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGreenII 0579-1 (35S:: LUC)
  • Backbone size w/o insert (bp) 5549
  • Total vector size (bp) 5580
  • Vector type
    Luciferase ; Plant Transformation

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    A luciferase gene disrupted by a QQR ZFN target site and a frame-shift mutation
  • Alt name
    Tfs-qqr::LUC
  • Alt name
    (+1) qqr 0579-1
  • Insert Size (bp)
    31
  • Mutation
    A disruption was made between the first and second triplet of the luciferase gene
  • Promoter 35S Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer RAJ-417 (CAACCACGTCTTCAAAGCAAGTG)
  • 3′ sequencing primer RAJ-365 (CCAGGAACCAGGGCGTATCTC)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGreenII Tfs-qqr::LUC was a gift from Roger Hellens & Ross Johnson (Addgene plasmid # 44466 ; http://n2t.net/addgene:44466 ; RRID:Addgene_44466)
Related items: