pHEX2 QQR ZFN
(Plasmid #44463)

• Depositing Labs: Roger Hellens, Ross Johnson
• Publication: Plasmids to assay for nuclease cleavage in planta (unpublished)

Backbone

• Vector backbone: pHEX2
• Backbone size w/o insert (bp): 13812
• Total vector size (bp): 14730
• Vector type: Plant Transformation
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: QQR ZFN
• Alt name: QQR Zinc-Finger Nuclease
• Species: Synthetic
• Insert Size (bp): 918
• Promoter: CaMV 35S

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: RAJ-417 (CAACCACGTCTTCAAAGCAAGTG)
• 3′ sequencing primer: m13 Forward

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The gene was obtained from 'pART7 QQR', as used in the Even-Faitelson et al. 2011 reference provided
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

QQR ZFN reference:
Even-Faitelson L, Samach A, Melamed-Bessudo C, Avivi-Ragolsky N, Levy AA (2011) Localized egg-cell expression of effector proteins for targeted modification of the Arabidopsis genome. The Plant Journal 68 (5):929-937. doi:10.1111/j.1365-313X.2011.04741.x

Please refer to the references provided below for matters relating to ownership of pHEX2 for anything other than academic use.

pHEX2 reference:
Hellens R, Allan A, Friel E, Bolitho K, Grafton K, Templeton M, Karunairetnam S, Gleave A, Laing W (2005) Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1 (1):13. doi:10.1186/1746-4811-1-13

pART27 (used to derive pHEX2) reference:
Gleave AP (1992) A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol Biol 20:1203-1207