Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pegfp-N1-TFEB-S3A,R4A
(Plasmid #44446)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44446 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 6152
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TFEB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1428
  • Mutation
    Changed both Serine 3 and Arginine 4 to Alanine
  • Entrez Gene
    TFEB (a.k.a. ALPHATFEB, BHLHE35, TCFEB)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Andrea Ballabio, TIGEM, Naples, Italy
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pegfp-N1-TFEB-S3A,R4A was a gift from Shawn Ferguson (Addgene plasmid # 44446 ; http://n2t.net/addgene:44446 ; RRID:Addgene_44446)
  • For your References section:

    The Transcription Factor TFEB Links mTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, Angarola B, Walther TC, Ferguson SM. Sci Signal. 2012 Jun 12;5(228):ra42. 10.1126/scisignal.2002790 PubMed 22692423